ID: 914652103_914652110

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 914652103 914652110
Species Human (GRCh38) Human (GRCh38)
Location 1:149704976-149704998 1:149705006-149705028
Sequence CCCTGGCCTGGTTGCTATGGGAG GGCCTGATGGAGCCTGAGGCAGG
Strand - +
Off-target summary {0: 4, 1: 0, 2: 2, 3: 20, 4: 179} {0: 6, 1: 3, 2: 2, 3: 40, 4: 557}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!