ID: 914662674_914662676 |
View in Genome Browser |
Spacer: -5 |
Left Crispr | Right Crispr | |
---|---|---|
Crispr ID | 914662674 | 914662676 |
Species | Human (GRCh38) | Human (GRCh38) |
Location | 1:149805527-149805549 | 1:149805545-149805567 |
Sequence | CCAAATCCTCATTCTGTGTTGTG | TTGTGCTGTCCCTAATTTAGAGG |
Strand | - | + |
Off-target summary | No data | {0: 3, 1: 0, 2: 0, 3: 11, 4: 104} |
Status | Not started |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer | Left Crispr | Right Crispr | ||||||
---|---|---|---|---|---|---|---|---|
Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
No off target data available for this pair! |