ID: 914677261_914677267

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 914677261 914677267
Species Human (GRCh38) Human (GRCh38)
Location 1:149914654-149914676 1:149914686-149914708
Sequence CCCATGTTTACAGGCTTCAACAA TTCTCTCAACATAGTCTAATGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 11, 4: 126}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!