ID: 914682303_914682308

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 914682303 914682308
Species Human (GRCh38) Human (GRCh38)
Location 1:149947175-149947197 1:149947206-149947228
Sequence CCATCCCAGATCTCCTTGTTCTG AATGAAATGAAGACACACCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 27, 4: 364} {0: 1, 1: 0, 2: 2, 3: 26, 4: 441}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!