ID: 914684047_914684054

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 914684047 914684054
Species Human (GRCh38) Human (GRCh38)
Location 1:149962364-149962386 1:149962386-149962408
Sequence CCCAGTTCATTATCCTCCTCCTA ACCATTCCCACTCCCAAGGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 20, 4: 237} {0: 1, 1: 0, 2: 1, 3: 14, 4: 138}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!