ID: 914703306_914703313

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 914703306 914703313
Species Human (GRCh38) Human (GRCh38)
Location 1:150152000-150152022 1:150152027-150152049
Sequence CCCGCCCTCACGGGAGGTATTCT TCCCTCACCCAGGGCTAACTGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 10, 4: 159}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!