ID: 914746702_914746706

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 914746702 914746706
Species Human (GRCh38) Human (GRCh38)
Location 1:150506466-150506488 1:150506508-150506530
Sequence CCCCCTTCAGACACGCGCGCGCA ACACACACAGTTTCTCTCTGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 57} {0: 2, 1: 0, 2: 10, 3: 53, 4: 401}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!