ID: 914754550_914754557

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 914754550 914754557
Species Human (GRCh38) Human (GRCh38)
Location 1:150555287-150555309 1:150555331-150555353
Sequence CCTGACCACCTCAGCTTGTGCTG CAGTGACCTGGGCAACCTCAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 28, 4: 196} {0: 1, 1: 0, 2: 1, 3: 10, 4: 189}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!