ID: 914764301_914764311

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 914764301 914764311
Species Human (GRCh38) Human (GRCh38)
Location 1:150624469-150624491 1:150624511-150624533
Sequence CCTGCAGCTCCGCTGCCAGAGAA CCAGAGGTAGGCTGGGAAAGTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 0, 3: 19, 4: 201} {0: 2, 1: 0, 2: 3, 3: 41, 4: 448}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!