ID: 914764310_914764315

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 914764310 914764315
Species Human (GRCh38) Human (GRCh38)
Location 1:150624511-150624533 1:150624524-150624546
Sequence CCAGAGGTAGGCTGGGAAAGTGG GGGAAAGTGGGCTGGGTCAGAGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 2, 3: 26, 4: 231} {0: 2, 1: 0, 2: 5, 3: 50, 4: 572}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!