ID: 914800833_914800839

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 914800833 914800839
Species Human (GRCh38) Human (GRCh38)
Location 1:150961136-150961158 1:150961170-150961192
Sequence CCACCTCAGGACTAGGCATCAAG CATCAAACAGGCCAAGAAAGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 107} {0: 1, 1: 0, 2: 0, 3: 13, 4: 247}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!