ID: 914825403_914825413

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 914825403 914825413
Species Human (GRCh38) Human (GRCh38)
Location 1:151135544-151135566 1:151135562-151135584
Sequence CCATCCCCTCCCTGCTTTGCAGG GCAGGGGGCCTGCCCTCCAAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 84, 4: 587} {0: 1, 1: 0, 2: 1, 3: 27, 4: 235}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!