ID: 914825403_914825416

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 914825403 914825416
Species Human (GRCh38) Human (GRCh38)
Location 1:151135544-151135566 1:151135572-151135594
Sequence CCATCCCCTCCCTGCTTTGCAGG TGCCCTCCAAAGGCCTCACCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 84, 4: 587} {0: 1, 1: 0, 2: 1, 3: 18, 4: 240}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!