ID: 914825403_914825420

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 914825403 914825420
Species Human (GRCh38) Human (GRCh38)
Location 1:151135544-151135566 1:151135577-151135599
Sequence CCATCCCCTCCCTGCTTTGCAGG TCCAAAGGCCTCACCGGGCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 84, 4: 587} {0: 1, 1: 0, 2: 0, 3: 12, 4: 126}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!