ID: 914829383_914829389

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 914829383 914829389
Species Human (GRCh38) Human (GRCh38)
Location 1:151159563-151159585 1:151159589-151159611
Sequence CCCATGTGAACCAAGGAAAGGAG CAGCCCAGAGAACCCCTTTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 21, 4: 200} {0: 1, 1: 0, 2: 1, 3: 17, 4: 151}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!