ID: 914829391_914829395

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 914829391 914829395
Species Human (GRCh38) Human (GRCh38)
Location 1:151159593-151159615 1:151159608-151159630
Sequence CCAGAGAACCCCTTTGGGGATAC GGGGATACTAAAGACAGAAGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 82} {0: 1, 1: 0, 2: 3, 3: 19, 4: 252}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!