ID: 914829392_914829398

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 914829392 914829398
Species Human (GRCh38) Human (GRCh38)
Location 1:151159601-151159623 1:151159614-151159636
Sequence CCCCTTTGGGGATACTAAAGACA ACTAAAGACAGAAGAGGGGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 119} {0: 1, 1: 1, 2: 4, 3: 64, 4: 626}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!