ID: 914831069_914831077

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 914831069 914831077
Species Human (GRCh38) Human (GRCh38)
Location 1:151171374-151171396 1:151171393-151171415
Sequence CCATGCAACAGGTGCATGTAAGA AAGATGTGGGGAGAGGGCTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 114} {0: 1, 1: 1, 2: 6, 3: 83, 4: 724}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!