ID: 914845719_914845735

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 914845719 914845735
Species Human (GRCh38) Human (GRCh38)
Location 1:151282594-151282616 1:151282636-151282658
Sequence CCGTAGCCGGGTAAACCCCCAGG CCTGGCGCCCCCGGCTCGAGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 34} {0: 1, 1: 0, 2: 0, 3: 7, 4: 88}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!