ID: 914866344_914866345

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 914866344 914866345
Species Human (GRCh38) Human (GRCh38)
Location 1:151432971-151432993 1:151433024-151433046
Sequence CCTTTTGAAATTTATGGTTGAAA TAGTCATTATTTTAACTGCTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 44, 4: 630} {0: 1, 1: 0, 2: 0, 3: 25, 4: 293}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!