ID: 914869108_914869120

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 914869108 914869120
Species Human (GRCh38) Human (GRCh38)
Location 1:151458760-151458782 1:151458811-151458833
Sequence CCGAGCGTGCGTGTGGACGTCGG GCGCGCGCGCGCGCCGCGGCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 27} {0: 1, 1: 0, 2: 5, 3: 90, 4: 504}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!