ID: 914895430_914895433

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 914895430 914895433
Species Human (GRCh38) Human (GRCh38)
Location 1:151667436-151667458 1:151667486-151667508
Sequence CCTTTTGGCCTTAACAATAAAAG GACTCTGAATGTACCATAGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 24, 4: 241} {0: 1, 1: 0, 2: 0, 3: 2, 4: 68}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!