ID: 914901198_914901202

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 914901198 914901202
Species Human (GRCh38) Human (GRCh38)
Location 1:151712054-151712076 1:151712067-151712089
Sequence CCAGCCTCCTTCTTCGTGGCCTG TCGTGGCCTGGCACTTCCTGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 27, 4: 320} {0: 1, 1: 0, 2: 0, 3: 9, 4: 152}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!