|
Left Crispr |
Right Crispr |
| Crispr ID |
914908903 |
914908917 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
1:151769140-151769162
|
1:151769191-151769213
|
| Sequence |
CCATCGTCATCATGGCCCATTCT |
CGGTGTGGCGGCCGGGCAGAGGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 91, 1: 532, 2: 969, 3: 791, 4: 250} |
{0: 2, 1: 199, 2: 1206, 3: 1091, 4: 1596} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|