|
Left Crispr |
Right Crispr |
Crispr ID |
914908905 |
914908917 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
1:151769155-151769177
|
1:151769191-151769213
|
Sequence |
CCCATTCTCAATGAGCTCTTGGG |
CGGTGTGGCGGCCGGGCAGAGGG |
Strand |
- |
+ |
Off-target summary |
{0: 1, 1: 139, 2: 1488, 3: 417, 4: 218} |
{0: 2, 1: 199, 2: 1206, 3: 1091, 4: 1596} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|