ID: 914909764_914909767

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 914909764 914909767
Species Human (GRCh38) Human (GRCh38)
Location 1:151775482-151775504 1:151775525-151775547
Sequence CCAGTCAGCACAATGAGTGAGTC TCCTCTTCCCACTGGTCACCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 82} {0: 1, 1: 0, 2: 8, 3: 29, 4: 259}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!