ID: 914928618_914928629

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 914928618 914928629
Species Human (GRCh38) Human (GRCh38)
Location 1:151909780-151909802 1:151909806-151909828
Sequence CCTCAGCCCCTCAGCCCCGGAAC CGCGCCGACTGGAGGCTTTGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 7, 3: 124, 4: 668} {0: 1, 1: 0, 2: 0, 3: 3, 4: 52}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!