ID: 914928622_914928631

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 914928622 914928631
Species Human (GRCh38) Human (GRCh38)
Location 1:151909794-151909816 1:151909829-151909851
Sequence CCCCGGAACCCGCGCGCCGACTG TCATCCTTCCCACATGACCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 44} {0: 1, 1: 0, 2: 0, 3: 24, 4: 198}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!