ID: 914932863_914932867

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 914932863 914932867
Species Human (GRCh38) Human (GRCh38)
Location 1:151950143-151950165 1:151950169-151950191
Sequence CCTCCCACTTGGGGACTTGGCCA CACTGCCCACATCCAGTGTGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 116} {0: 1, 1: 0, 2: 2, 3: 23, 4: 176}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!