ID: 914947560_914947568 |
View in Genome Browser |
Spacer: 25 |
| Left Crispr | Right Crispr | |
|---|---|---|
| Crispr ID | 914947560 | 914947568 |
| Species | Human (GRCh38) | Human (GRCh38) |
| Location | 1:152080205-152080227 | 1:152080253-152080275 |
| Sequence | CCAGGAGGAAGTGAGGTTTCCCT | GGCTGCTTCCCCATTGCTACAGG |
| Strand | - | + |
| Off-target summary | No data | {0: 8, 1: 4, 2: 1, 3: 4, 4: 94} |
| Status | Not started | |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer | Left Crispr | Right Crispr | ||||||
|---|---|---|---|---|---|---|---|---|
| Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
| No off target data available for this pair! | ||||||||