ID: 914947562_914947568

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 914947562 914947568
Species Human (GRCh38) Human (GRCh38)
Location 1:152080224-152080246 1:152080253-152080275
Sequence CCCTGAGTCTCCAGGAGACTAGA GGCTGCTTCCCCATTGCTACAGG
Strand - +
Off-target summary No data {0: 8, 1: 4, 2: 1, 3: 4, 4: 94}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!