ID: 914965795_914965812

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 914965795 914965812
Species Human (GRCh38) Human (GRCh38)
Location 1:152256312-152256334 1:152256365-152256387
Sequence CCTCACTTCCCAGATGGGGTGGC ATGGGGCAGCTGCCGGGCGGAGG
Strand - +
Off-target summary {0: 532, 1: 2666, 2: 5168, 3: 10303, 4: 6855} {0: 19, 1: 345, 2: 772, 3: 1086, 4: 1675}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!