ID: 914965799_914965806

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 914965799 914965806
Species Human (GRCh38) Human (GRCh38)
Location 1:152256321-152256343 1:152256347-152256369
Sequence CCAGATGGGGTGGCTGCCGGGTG GGGCTCCTCACTTCTCAGATGGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!