ID: 914965808_914965812

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 914965808 914965812
Species Human (GRCh38) Human (GRCh38)
Location 1:152256352-152256374 1:152256365-152256387
Sequence CCTCACTTCTCAGATGGGGCAGC ATGGGGCAGCTGCCGGGCGGAGG
Strand - +
Off-target summary {0: 40, 1: 635, 2: 2227, 3: 3801, 4: 10783} {0: 19, 1: 345, 2: 772, 3: 1086, 4: 1675}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!