ID: 914993098_914993111

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 914993098 914993111
Species Human (GRCh38) Human (GRCh38)
Location 1:152515468-152515490 1:152515493-152515515
Sequence CCCACCCCGGCGCCCGCCTCCTC CCTCCTGCTGCGGCTCCGGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 7, 3: 61, 4: 743} {0: 1, 1: 0, 2: 4, 3: 36, 4: 400}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!