ID: 914993107_914993115

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 914993107 914993115
Species Human (GRCh38) Human (GRCh38)
Location 1:152515487-152515509 1:152515504-152515526
Sequence CCTCCTCCTCCTGCTGCGGCTCC GGCTCCGGCAGGGGCTGCTGCGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 52, 3: 435, 4: 4909} {0: 1, 1: 0, 2: 7, 3: 91, 4: 658}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!