ID: 914993433_914993441

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 914993433 914993441
Species Human (GRCh38) Human (GRCh38)
Location 1:152517816-152517838 1:152517857-152517879
Sequence CCCTGATGGTGGTGGTACCTCCA ACCCAGCAGGTCAGCACACATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 119} {0: 1, 1: 0, 2: 2, 3: 33, 4: 244}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!