ID: 914998520_914998530

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 914998520 914998530
Species Human (GRCh38) Human (GRCh38)
Location 1:152565806-152565828 1:152565851-152565873
Sequence CCAGCTCAGCCTGTGAAAGTCAG GCGTCAGATGGGGCTGTTCTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 255} {0: 1, 1: 0, 2: 0, 3: 12, 4: 90}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!