ID: 915004368_915004372

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 915004368 915004372
Species Human (GRCh38) Human (GRCh38)
Location 1:152622994-152623016 1:152623021-152623043
Sequence CCAGAGCTTGGGGCACAGCTGGA GCTGGAGGCAGACACTGTGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 38, 4: 280} {0: 1, 1: 3, 2: 4, 3: 41, 4: 403}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!