ID: 915004368_915004375

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 915004368 915004375
Species Human (GRCh38) Human (GRCh38)
Location 1:152622994-152623016 1:152623034-152623056
Sequence CCAGAGCTTGGGGCACAGCTGGA ACTGTGCTGGGCTCTTTGCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 38, 4: 280} {0: 1, 1: 0, 2: 4, 3: 36, 4: 427}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!