ID: 915011100_915011107

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 915011100 915011107
Species Human (GRCh38) Human (GRCh38)
Location 1:152686992-152687014 1:152687021-152687043
Sequence CCATCTCTGGGGGCTGCTGTGGT TCTGGGGGCTGCTGCAACTCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 8, 3: 46, 4: 416} {0: 1, 1: 7, 2: 2, 3: 34, 4: 252}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!