ID: 915059012_915059016

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 915059012 915059016
Species Human (GRCh38) Human (GRCh38)
Location 1:153164361-153164383 1:153164398-153164420
Sequence CCAGCAACTATTCCTGGAGAAAG ATCTCTAATCCAATGCTGATGGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!