ID: 915078846_915078859

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 915078846 915078859
Species Human (GRCh38) Human (GRCh38)
Location 1:153337448-153337470 1:153337488-153337510
Sequence CCTTGCCAATGGAGTGCTGGTAA GAGGGAGGCAGGGTAGGGAGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 101} {0: 1, 1: 2, 2: 44, 3: 483, 4: 3252}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!