ID: 915089757_915089768

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 915089757 915089768
Species Human (GRCh38) Human (GRCh38)
Location 1:153416286-153416308 1:153416316-153416338
Sequence CCCTCAAATCAAGATTGAGCCAG CCCAGGTGAGGTCTCTGGGGTGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 3, 3: 43, 4: 344}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!