ID: 915089757_915089775

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 915089757 915089775
Species Human (GRCh38) Human (GRCh38)
Location 1:153416286-153416308 1:153416336-153416358
Sequence CCCTCAAATCAAGATTGAGCCAG TGGGGTGGGACCTGGTGACCTGG
Strand - +
Off-target summary No data {0: 2, 1: 0, 2: 4, 3: 44, 4: 385}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!