ID: 915092764_915092770

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 915092764 915092770
Species Human (GRCh38) Human (GRCh38)
Location 1:153438134-153438156 1:153438150-153438172
Sequence CCCCGCACAAATATAAAAGCTCT AAGCTCTCCCAGCCAAGGGCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 117} {0: 1, 1: 0, 2: 2, 3: 11, 4: 233}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!