ID: 915108030_915108036

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 915108030 915108036
Species Human (GRCh38) Human (GRCh38)
Location 1:153546500-153546522 1:153546519-153546541
Sequence CCCCATGCCCGGTACTGTCTGCC TGCCATGCCAAGTAAGGCTCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 105} {0: 1, 1: 0, 2: 0, 3: 5, 4: 115}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!