ID: 915118811_915118822

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 915118811 915118822
Species Human (GRCh38) Human (GRCh38)
Location 1:153616064-153616086 1:153616101-153616123
Sequence CCAGGCCCCGCCTGGGCTTCAGG CCCCCAGGCCAACGCATCTAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 51, 4: 415} {0: 1, 1: 0, 2: 0, 3: 9, 4: 66}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!