ID: 915128077_915128090

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 915128077 915128090
Species Human (GRCh38) Human (GRCh38)
Location 1:153679470-153679492 1:153679519-153679541
Sequence CCGCCGCCCCAGTGGGGCGCTTC GACCGCCGGCGCCCCGGCGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 96} {0: 1, 1: 0, 2: 1, 3: 21, 4: 183}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!