ID: 915142489_915142497

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 915142489 915142497
Species Human (GRCh38) Human (GRCh38)
Location 1:153776109-153776131 1:153776136-153776158
Sequence CCCCCTGCTGCACTGCCTCCGCA CGGCGCGCGCGCGCTGGTGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 31, 4: 311} {0: 1, 1: 0, 2: 0, 3: 29, 4: 186}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!